Aptamer-target interaction descriptor
Aptamer-target interaction information
Interaction ID: 619
Aptamer sequence: GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC
Target unique ID: 104730
Aptamer ID Aptamer descriptor Target chemistry Target name Affinity Binding Conditions/Buffer PubMed ID
Apta_563 AR1 Molecule Cobalt 100 μM 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 11283591
Structure information of aptamer
Aptamer Sequence: GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC
The optimal secondary structure in dot-bracket notation: ........(((((.((((((....))))))((((((.....((....))....(((.(((...)))))))))))).......)))))(((....))).
The centroid secondary structure in dot-bracket notation: ..............((((((....))))))((((((.....((....))....(((.((.....))))))))))).(((.....))).((....))..
The MFE structure
The Centroid structure
The mountain plot representation
Aptamer information
Type Detail Type Detail
Aptamer ID Apta_563 Description AR1
Aptamer chemistry RNA Length 98 nt
GC content 54.1% Molecular weight 31,742.02 Da
Molarity of 1 μg/μl solution 31.50 μM Number of G-quadruplexes No QGRS found
G-Score N/A Function Aptasensor
Sequence GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC
Applications Recognition of cAMP
Target information
Type Detail Type Detail
PubChem ID 104730 Molecular name Cobalt
Molecular formula Co Molecular weight 58.93
IUPAC name cobalt InChIKey GUTLYIVDDKVIGB-UHFFFAOYSA-N
LogP -0.003 Topological polar surface area 0
Hydrogen bond acceptor 0 Hydrogen bond donor 0

Synonym(s):
7440-48-4; Co; Cobalt; Kobalt; cobalto; Cobalt moncation; Cobalt, elemental; cobalt(1+); cobaltum; Cobalt powder; Cobalt, ion (Co1+); Co1+; Cobalt (II) ion; UNII-3G0H8C9362; 27Co; Cobalt Nanowires; CHEBI:27638; MFCD00010935; 3G0H8C9362; Cobalt metal powder; Cobalt fume; Kobalt [German, Polish]; hydrido cobalt; cobalt atom; Cobalt hydride; Cobalt pieces; Cobalt Chelate; Cobalt Nanofoil; Cobalt Nanorods; CCRIS 1575; Cobalt, foil, 100x100mm, thickness 0.125mm, annealed, 99.9%; Cobalt, foil, 10mm disks, thickness 0.125mm, annealed, 99.9%; Cobalt, foil, 15mm disks, thickness 0.125mm, annealed, 99.9%; Cobalt, foil, 25mm disks, thickness 0.125mm, annealed, 99.9%; Cobalt, foil, 4mm disks, thickness 0.125mm, annealed, 99.9%; Cobalt, foil, 6mm disks, thickness 0.125mm, annealed, 99.9%; Cobalt, foil, 8mm disks, thickness 0.125mm, annealed, 99.9%; HSDB 519; cobalt(I); cobalt(I) ion; NCI-C60311; Fine Cobalt Powder; Cobalt Nanoparticles; cobalt(iii) hydride; EINECS 231-158-0; Cobalt random pieces; cobalt (1+) ion; Cobalt Nano Dispersion; CI 77320; Cobalt Yeast 18 mcg/gm; C.I. 77320; Epitope ID:114073; Ultra Thin Cobalt Nanofoil; EC 231-158-0; Cobalt powder (99.8%); Cobalt foil, 3N ;99%; Cobalt metal, dust and fume; Cobalt powder, -325 mesh; Cobalt powder, -400 mesh; Cobalt powder, 1.6 micron; Co(+); Cobalt and inorganic compounds; Cobalt Nanoparticle Dispersion; Cobalt, p.a., 99.5%; Carbon Coated Cobalt Nanopowder; DTXSID1031040; CHEBI:85033; Cobalt nanopowder, APS 5-15nm; Cobalt rod, 5mm (0.2in) dia; DTXSID50872436; Cobalt nanopowder, APS 25-30nm; 8438AF; AKOS015902736; Cobalt Silica Core Shell Nanoparticles; Cobalt wire, 1.5mm (0.06in) dia; Cobalt wire, 2.0mm (0.08in) dia; DB14574; Cobalt foil, 0.025mm (0.001in); Cobalt foil, 0.5mm (0.02in) thick; Cobalt foil, 1.0mm (0.04in) thick; Cobalt foil, 1.5mm (0.06in) thick; Cobalt foil, 2.0mm (0.08in) thick; Cobalt foil, 0.1mm (0.004in) thick; Cobalt foil, 0.25mm (0.01in) thick; Cobalt rod, 12.5mm (0.492in) dia; Cobalt foil, 0.05mm (0.002in) thick; Cobalt powder, spherical, -100+325 mesh; Cobalt, pieces, 99.5% trace metals basis; Cobalt, puriss. p.a., >=99.8%, powder; Cobalt, wire, diam. 0.5 mm, >=99.9%; Cobalt, wire, diam. 2.0 mm, >=99.9%; FT-0623994; Cobalt, foil, thickness 0.25 mm, 99.95%; Cobalt, wire, diam. 0.25 mm, 99.995%; C19171; Cobalt, foil, thickness 0.1 mm, >=99.99%; Cobalt, foil, thickness 1.0 mm, >=99.99%; Cobalt, granular, 99.995% trace metals basis; Cobalt wire, 0.5mm (0.02in) dia, Puratronic; Cobalt foil, 0.1mm (0.004in) thick, Puratronic?; Cobalt Powder, 99.8% (metal basis, O<10%) Nano; Cobalt powder, -22 mesh, 99.998% (metals basis); Cobalt, foil, 4mm disks, thickness 0.01mm, 99.9%; Cobalt, foil, 4mm disks, thickness 0.02mm, 99.9%; Cobalt, foil, 6mm disks, thickness 0.01mm, 99.9%; Cobalt, foil, 6mm disks, thickness 0.02mm, 99.9%; Cobalt, foil, 8mm disks, thickness 0.01mm, 99.9%; Cobalt, foil, 8mm disks, thickness 0.02mm, 99.9%; Q27158297; Cobalt, foil, 10mm disks, thickness 0.003mm, 99.9%; Cobalt, foil, 10mm disks, thickness 0.004mm, 99.9%; Cobalt, foil, 10mm disks, thickness 0.005mm, 99.9%; Cobalt, foil, 10mm disks, thickness 0.006mm, 99.9%; Cobalt, foil, 10mm disks, thickness 0.007mm, 99.9%; Cobalt, foil, 10mm disks, thickness 0.008mm, 99.9%; Cobalt, foil, 10mm disks, thickness 0.009mm, 99.9%; Cobalt, foil, 10mm disks, thickness 0.015mm, 99.9%; Cobalt, foil, 10mm disks, thickness 0.01mm, 99.9%; Cobalt, foil, 10mm disks, thickness 0.025mm, 99.9%; Cobalt, foil, 10mm disks, thickness 0.02mm, 99.9%; Cobalt, foil, 15mm disks, thickness 0.003mm, 99.9%; Cobalt, foil, 15mm disks, thickness 0.004mm, 99.9%; Cobalt, foil, 15mm disks, thickness 0.005mm, 99.9%; Cobalt, foil, 15mm disks, thickness 0.006mm, 99.9%; Cobalt, foil, 15mm disks, thickness 0.007mm, 99.9%; Cobalt, foil, 15mm disks, thickness 0.008mm, 99.9%; Cobalt, foil, 15mm disks, thickness 0.009mm, 99.9%; Cobalt, foil, 15mm disks, thickness 0.015mm, 99.9%; Cobalt, foil, 15mm disks, thickness 0.01mm, 99.9%; Cobalt, foil, 15mm disks, thickness 0.025mm, 99.9%; Cobalt, foil, 15mm disks, thickness 0.02mm, 99.9%; Cobalt, foil, 25mm disks, thickness 0.015mm, 99.9%; Cobalt, foil, 25mm disks, thickness 0.01mm, 99.9%; Cobalt, foil, 25mm disks, thickness 0.025mm, 99.9%; Cobalt, foil, 4mm disks, thickness 0.003mm, 99.9%; Cobalt, foil, 4mm disks, thickness 0.004mm, 99.9%; Cobalt, foil, 4mm disks, thickness 0.005mm, 99.9%; Cobalt, foil, 4mm disks, thickness 0.006mm, 99.9%; Cobalt, foil, 4mm disks, thickness 0.007mm, 99.9%; Cobalt, foil, 4mm disks, thickness 0.008mm, 99.9%; Cobalt, foil, 4mm disks, thickness 0.009mm, 99.9%; Cobalt, foil, 4mm disks, thickness 0.0125mm, 99.9%; Cobalt, foil, 4mm disks, thickness 0.015mm, 99.9%; Cobalt, foil, 4mm disks, thickness 0.025mm, 99.9%; Cobalt, foil, 6mm disks, thickness 0.003mm, 99.9%; Cobalt, foil, 6mm disks, thickness 0.004mm, 99.9%; Cobalt, foil, 6mm disks, thickness 0.005mm, 99.9%; Cobalt, foil, 6mm disks, thickness 0.006mm, 99.9%; Cobalt, foil, 6mm disks, thickness 0.007mm, 99.9%; Cobalt, foil, 6mm disks, thickness 0.008mm, 99.9%; Cobalt, foil, 6mm disks, thickness 0.009mm, 99.9%; Cobalt, foil, 6mm disks, thickness 0.0125mm, 99.9%; Cobalt, foil, 6mm disks, thickness 0.015mm, 99.9%; Cobalt, foil, 6mm disks, thickness 0.025mm, 99.9%; Cobalt, foil, 8mm disks, thickness 0.003mm, 99.9%; Cobalt, foil, 8mm disks, thickness 0.004mm, 99.9%; Cobalt, foil, 8mm disks, thickness 0.005mm, 99.9%; Cobalt, foil, 8mm disks, thickness 0.006mm, 99.9%; Cobalt, foil, 8mm disks, thickness 0.007mm, 99.9%; Cobalt, foil, 8mm disks, thickness 0.008mm, 99.9%; Cobalt, foil, 8mm disks, thickness 0.009mm, 99.9%; Cobalt, foil, 8mm disks, thickness 0.0125mm, 99.9%; Cobalt, foil, 8mm disks, thickness 0.015mm, 99.9%; Cobalt, foil, 8mm disks, thickness 0.025mm, 99.9%; Cobalt rod, 5mm (0.2in) dia, 99.995% (metals basis); Cobalt, foil, 10mm disks, thickness 0.0125mm, 99.9%; Cobalt, foil, 15mm disks, thickness 0.0125mm, 99.9%; Cobalt, foil, 25mm disks, thickness 0.0125mm, 99.9%; Cobalt, powder, <150 mum, >=99.9% trace metals basis; Cobalt, rod, diam. 5.0 mm, 99.95% trace metals basis; Cobalt, rod, diam. 5.0 mm, 99.998% trace metals basis; Cobalt, wire reel, 0.1m, diameter 0.05mm, hard, 99.9%; Cobalt, wire reel, 0.2m, diameter 0.05mm, hard, 99.9%; Cobalt, wire reel, 0.5m, diameter 0.05mm, hard, 99.9%; Cobalt, wire reel, 1m, diameter 0.05mm, hard, 99.9%; Cobalt, wire reel, 1m, diameter 0.1mm, hard, 99.99+%; Cobalt, wire reel, 1m, diameter 0.25mm, hard, 99.99+%; Cobalt, wire reel, 1m, diameter 0.5mm, hard, 99.99+%; Cobalt, wire reel, 2m, diameter 0.05mm, hard, 99.9%; Cobalt, wire reel, 2m, diameter 0.1mm, hard, 99.99+%; Cobalt, wire reel, 2m, diameter 0.25mm, hard, 99.99+%; Cobalt, wire, diam. 1.0 mm, 99.995% trace metals basis; Cobalt foil, 0.127mm (0.005in) thick, 50x50mm (2x2in); Cobalt rod, 12mm (0.47in) dia, 99.995% (metals basis); Cobalt wire, 1.0mm (0.04in) dia, 99.995% (metals basis); Cobalt wire, 2.0mm (0.08in) dia, 99.995% (metals basis); Cobalt, foil, 0.5m coil, thickness 0.05mm, annealed, 99.9%; Cobalt, foil, 0.5m coil, thickness 0.50mm, annealed, 99.9%; Cobalt, foil, 0.5m coil, thickness 1.0mm, annealed, 99.9%; Cobalt, foil, 100x100mm, thickness 0.7mm, annealed, 99.9%; Cobalt, foil, 100x100mm, thickness 1.0mm, annealed, 99.9%; Cobalt, foil, 1m coil, thickness 0.05mm, annealed, 99.9%; Cobalt, foil, 1m coil, thickness 0.125mm, annealed, 99.9%; Cobalt, foil, 250x250mm, thickness 1.0mm, annealed, 99.9%; Cobalt, foil, 25x25mm, thickness 0.125mm, annealed, 99.9%; Cobalt, foil, 25x25mm, thickness 0.25mm, as rolled, 99.9%; Cobalt, foil, 25x25mm, thickness 0.7mm, annealed, 99.9%; Cobalt, foil, 25x25mm, thickness 1.0mm, as rolled, 99.9%; Cobalt, foil, 4mm disks, thickness 0.05mm, annealed, 99.9%; Cobalt, foil, 50x50mm, thickness 0.125mm, annealed, 99.9%; Cobalt, foil, 50x50mm, thickness 0.25mm, as rolled, 99.9%; Cobalt, foil, 50x50mm, thickness 0.7mm, annealed, 99.9%; Cobalt, foil, 50x50mm, thickness 1.0mm, as rolled, 99.9%; Cobalt, foil, 50x50mm, thickness 2.0mm, as rolled, 99.9%; Cobalt, foil, 6mm disks, thickness 0.05mm, annealed, 99.9%; Cobalt, foil, 8mm disks, thickness 0.05mm, annealed, 99.9%; Cobalt, foil, thickness 0.1 mm, 99.95% trace metals basis; Cobalt, foil, thickness 1.0 mm, 99.95% trace metals basis; Cobalt, powder, 2 mum particle size, 99.8% trace metals basis; Cobalt, rod, 10 mm diameter, length 100 mm, purity 99.9%; Cobalt, rod, 10 mm diameter, length 200 mm, purity 99.9%; Cobalt, rod, 10 mm diameter, length 25 mm, purity 99.9%; Cobalt, rod, 10 mm diameter, length 50 mm, purity 99.9%; Cobalt, rod, 12 mm diameter, length 100 mm, purity 99.9%; Cobalt, rod, 12 mm diameter, length 200 mm, purity 99.9%; Cobalt, rod, 12 mm diameter, length 25 mm, purity 99.9%; Cobalt, rod, 12 mm diameter, length 50 mm, purity 99.9%; Cobalt, rod, 25 mm diameter, length 100 mm, purity 99.9%; Cobalt, rod, 25 mm diameter, length 25 mm, purity 99.9%; Cobalt, rod, 25 mm diameter, length 50 mm, purity 99.9%; Cobalt, rod, 3.0 mm diameter, length 200 mm, purity 99.9%; Cobalt, rod, 3.0 mm diameter, length 50 mm, purity 99.9%; Cobalt, rod, 3.0 mm diameter, purity 99.9%, length 500 mm; Cobalt, rod, 6.35 mm diameter, length 25 mm, purity 99.9%; Cobalt, rod, 6.35 mm diameter, length 50 mm, purity 99.9%; Cobalt, rod, length 100 mm, 3.0 mm diameter, purity 99.9%; Cobalt, wire reel, 0.025m, diameter 2.0mm, hard, 99.99+%; Cobalt, wire reel, 0.05m, diameter 0.25mm, hard, 99.99+%; Cobalt, wire reel, 0.05m, diameter 0.5mm, hard, 99.99+%; Cobalt, wire reel, 0.05m, diameter 1.0mm, hard, 99.99+%; Cobalt, wire reel, 0.05m, diameter 2.0mm, hard, 99.99+%; Cobalt, wire reel, 0.1m, diameter 0.125mm, hard, 99.99+%; Cobalt, wire reel, 0.1m, diameter 0.1mm, hard, 99.99+%; Cobalt, wire reel, 0.1m, diameter 0.25mm, hard, 99.99+%; Cobalt, wire reel, 0.1m, diameter 0.5mm, hard, 99.99+%; Cobalt, wire reel, 0.1m, diameter 1.0mm, hard, 99.99+%; Cobalt, wire reel, 0.1m, diameter 2.0mm, hard, 99.99+%; Cobalt, wire reel, 0.2m, diameter 0.125mm, hard, 99.99+%; Cobalt, wire reel, 0.2m, diameter 0.1mm, hard, 99.99+%; Cobalt, wire reel, 0.2m, diameter 0.25mm, hard, 99.99+%; Cobalt, wire reel, 0.2m, diameter 0.5mm, hard, 99.99+%; Cobalt, wire reel, 0.2m, diameter 1.0mm, hard, 99.99+%; Cobalt, wire reel, 0.2m, diameter 2.0mm, hard, 99.99+%; Cobalt, wire reel, 0.5m, diameter 0.125mm, hard, 99.99+%; Cobalt, wire reel, 0.5m, diameter 0.1mm, hard, 99.99+%; Cobalt, wire reel, 0.5m, diameter 0.25mm, hard, 99.99+%; Cobalt, wire reel, 0.5m, diameter 0.5mm, hard, 99.99+%; Cobalt, wire reel, 0.5m, diameter 1.0mm, hard, 99.99+%; Cobalt, wire reel, 1m, diameter 0.125mm, hard, 99.99+%; Cobalt, wire reel, 2m, diameter 0.125mm, hard, 99.99+%; Cobalt foil, 0.25mm (0.01in) thick, 99.995% (metals basis); Cobalt foil, 0.5mm (0.02in) thick, 99.995% (metals basis); Cobalt foil, 2.0mm (0.08in) thick, 99.995% (metals basis); Cobalt lump, typically 1.5cm cubes, vacuum remelted, low oxygen; Cobalt Powder (carbon coated), 99.8% (metal basis, O<10%) Nano; Cobalt slug, 3.175mm (0.125in) dia x 6.35mm (0.25in) length; Cobalt slug, 6.35mm (0.25in) dia x 12.7mm (0.50in) length; Cobalt slug, 6.35mm (0.25in) dia x 6.35mm (0.25in) length; Cobalt wire, 0.1mm (0.004in) dia, 99.995% (metals basis); Cobalt wire, 0.25mm (0.01in) dia, 99.995% (metals basis); Cobalt, foil, 0.5m coil, thickness 0.125mm, annealed, 99.9%; Cobalt, foil, 100x100mm, thickness 0.25mm, as rolled, 99.9%; Cobalt, foil, 100x100mm, thickness 0.25mm, as rolled, 99.99+%; Cobalt, foil, 100x100mm, thickness 0.50mm, annealed, 99.9%; Cobalt, foil, 100x100mm, thickness 0.5mm, as rolled, 99.99+%; Cobalt, foil, 100x100mm, thickness 1.0mm, as rolled, 99.9%; Cobalt, foil, 100x100mm, thickness 2.0mm, as rolled, 99.9%; Cobalt, foil, 10mm disks, thickness 0.05mm, annealed, 99.9%; Cobalt, foil, 10mm disks, thickness 0.05mm, as rolled, 99.9%; Cobalt, foil, 10mm disks, thickness 0.05mm, as rolled, 99.99+%; Cobalt, foil, 10mm disks, thickness 0.25mm, as rolled, 99.9%; Cobalt, foil, 10mm disks, thickness 0.25mm, as rolled, 99.99+%; Cobalt, foil, 150x150mm, thickness 0.125mm, annealed, 99.9%; Cobalt, foil, 15mm disks, thickness 0.05mm, annealed, 99.9%; Cobalt, foil, 15mm disks, thickness 0.05mm, as rolled, 99.9%; Cobalt, foil, 15mm disks, thickness 0.05mm, as rolled, 99.99+%; Cobalt, foil, 15mm disks, thickness 0.25mm, as rolled, 99.9%; Cobalt, foil, 15mm disks, thickness 0.25mm, as rolled, 99.99+%; Cobalt, foil, 250x250mm, thickness 0.125mm, annealed, 99.9%; Cobalt, foil, 250x250mm, thickness 0.50mm, annealed, 99.9%; Cobalt, foil, 25mm disks, thickness 0.05mm, annealed, 99.9%; Cobalt, foil, 25mm disks, thickness 0.05mm, as rolled, 99.9%; Cobalt, foil, 25mm disks, thickness 0.25mm, as rolled, 99.9%; Cobalt, foil, 25mm disks, thickness 0.25mm, as rolled, 99.99+%; Cobalt, foil, 25x25mm, thickness 0.125mm, as rolled, 99.99+%; Cobalt, foil, 25x25mm, thickness 0.25mm, as rolled, 99.99+%; Cobalt, foil, 25x25mm, thickness 0.5mm, as rolled, 99.99+%; Cobalt, foil, 25x25mm, thickness 1.0mm, as rolled, 99.99+%; Cobalt, foil, 4mm disks, thickness 0.05mm, as rolled, 99.9%; Cobalt, foil, 4mm disks, thickness 0.05mm, as rolled, 99.99+%; Cobalt, foil, 4mm disks, thickness 0.125mm, as rolled, 99.99+%; Cobalt, foil, 4mm disks, thickness 0.25mm, as rolled, 99.9%; Cobalt, foil, 4mm disks, thickness 0.25mm, as rolled, 99.99+%; Cobalt, foil, 50mm disks, thickness 0.05mm, annealed, 99.9%; Cobalt, foil, 50mm disks, thickness 0.125mm, annealed, 99.9%; Cobalt, foil, 50x50mm, thickness 0.125mm, as rolled, 99.99+%; Cobalt, foil, 50x50mm, thickness 0.25mm, as rolled, 99.99+%; Cobalt, foil, 50x50mm, thickness 0.5mm, as rolled, 99.99+%; Cobalt, foil, 50x50mm, thickness 1.0mm, as rolled, 99.99+%; Cobalt, foil, 6mm disks, thickness 0.05mm, as rolled, 99.9%; Cobalt, foil, 6mm disks, thickness 0.05mm, as rolled, 99.99+%; Cobalt, foil, 6mm disks, thickness 0.125mm, as rolled, 99.99+%; Cobalt, foil, 6mm disks, thickness 0.25mm, as rolled, 99.9%; Cobalt, foil, 6mm disks, thickness 0.25mm, as rolled, 99.99+%; Cobalt, foil, 8mm disks, thickness 0.05mm, as rolled, 99.9%; Cobalt, foil, 8mm disks, thickness 0.05mm, as rolled, 99.99+%; Cobalt, foil, 8mm disks, thickness 0.125mm, as rolled, 99.99+%; Cobalt, foil, 8mm disks, thickness 0.25mm, as rolled, 99.9%; Cobalt, foil, 8mm disks, thickness 0.25mm, as rolled, 99.99+%; Cobalt, foil, light tested, 25x25mm, thickness 0.009mm, 99.9%; Cobalt, foil, light tested, 25x25mm, thickness 0.0125mm, 99.9%; Cobalt, foil, light tested, 25x25mm, thickness 0.015mm, 99.9%; Cobalt, foil, light tested, 25x25mm, thickness 0.01mm, 99.9%; Cobalt, foil, light tested, 25x25mm, thickness 0.025mm, 99.9%; Cobalt, foil, light tested, 25x25mm, thickness 0.02mm, 99.9%; Cobalt, foil, light tested, 50x50mm, thickness 0.009mm, 99.9%; Cobalt, foil, light tested, 50x50mm, thickness 0.0125mm, 99.9%; Cobalt, foil, light tested, 50x50mm, thickness 0.015mm, 99.9%; Cobalt, foil, light tested, 50x50mm, thickness 0.01mm, 99.9%; Cobalt, foil, light tested, 50x50mm, thickness 0.025mm, 99.9%; Cobalt, foil, light tested, 50x50mm, thickness 0.02mm, 99.9%; Cobalt, foil, thickness 0.25 mm, >=99.99% trace metals basis; Cobalt, foil, thickness 0.50 mm, size 50 x 50 mm, purity 99.9%; Cobalt, foil, thickness 1.0 mm, size 50 x 50 mm, purity 99.9%; Cobalt, foil, thickness 2.0 mm, size 25 x 25 mm, purity 99.9%; Cobalt, lump, 10 mm max. lump size, weight 10 g, purity 99.9%; Cobalt, lump, 10 mm max. lump size, weight 100 g, purity 99.9%; Cobalt, lump, 10 mm max. lump size, weight 20 g, purity 99.9%; Cobalt, lump, 10 mm max. lump size, weight 50 g, purity 99.9%; Cobalt, lump, 40 mm max. lump size, weight 100 g, purity 99.8%; Cobalt, lump, 40 mm max. lump size, weight 200 g, purity 99.8%; Cobalt, lump, 40 mm max. lump size, weight 500 g, purity 99.8%; Cobalt, rod, 1.5 mm diameter, length 25 mm, high purity 99.99+%; Cobalt, rod, 1.5 mm diameter, length 50 mm, high purity 99.99+%; Cobalt, rod, 2.0 mm diameter, length 2 mm, high purity 99.99+%; Cobalt, rod, 2.0 mm diameter, length 50 mm, high purity 99.99+%; Cobalt, rod, 5.0 mm diameter, length 25 mm, high purity 99.99+%; Cobalt, rod, 5.0 mm diameter, length 50 mm, high purity 99.99+%; Cobalt, rod, 6.35 mm diameter, length 100 mm, purity 99.9%; Cobalt, rod, 6.35 mm diameter, length 200 mm, purity 99.9%; Cobalt, rod, length 25 mm, 2.0 mm diameter, high purity 99.99+%; Cobalt single crystal, 10-12mm (0.39-0.47in) dia, random orientation; Cobalt slug, 3.175mm (0.125in) dia x 3.175mm (0.125in) length; Cobalt slug, 6.35mm (0.25in) dia x 12.7mm (0.50in) length, Puratronic; Cobalt sputtering target, 50.8mm (2.0in) dia x 3.18mm (0.125in) thick; Cobalt sputtering target, 50.8mm (2.0in) dia x 6.35mm (0.250in) thick; Cobalt sputtering target, 76.2mm (3.0in) dia x 3.18mm (0.125in) thick; Cobalt sputtering target, 76.2mm (3.0in) dia x 6.35mm (0.250in) thick; Cobalt wire, 1.5mm (0.06in) dia, annealed, 99.995% (metals basis); Cobalt, foil, 100x100mm, thickness 0.125mm, as rolled, 99.99+%; Cobalt, foil, 10mm disks, thickness 0.125mm, as rolled, 99.99+%; Cobalt, foil, 15mm disks, thickness 0.125mm, as rolled, 99.99+%; Cobalt, foil, light tested, 25x25mm, thickness 0.05mm, as rolled, 99.9%; Cobalt, foil, light tested, 50x50mm, thickness 0.05mm, as rolled, 99.9%; Cobalt, foil, not light tested, 100x100mm, thickness 0.003mm, 99.9%; Cobalt, foil, not light tested, 100x100mm, thickness 0.004mm, 99.9%; Cobalt, foil, not light tested, 100x100mm, thickness 0.005mm, 99.9%; Cobalt, foil, not light tested, 100x100mm, thickness 0.006mm, 99.9%; Cobalt, foil, not light tested, 100x100mm, thickness 0.007mm, 99.9%; Cobalt, foil, not light tested, 100x100mm, thickness 0.008mm, 99.9%; Cobalt, foil, not light tested, 100x100mm, thickness 0.009mm, 99.9%; Cobalt, foil, not light tested, 100x100mm, thickness 0.0125mm, 99.9%; Cobalt, foil, not light tested, 100x100mm, thickness 0.01mm, 99.9%; Cobalt, foil, not light tested, 100x100mm, thickness 0.025mm, 99.9%; Cobalt, foil, not light tested, 100x100mm, thickness 0.02mm, 99.9%; Cobalt, foil, not light tested, 150x150mm, thickness 0.0125mm, 99.9%; Cobalt, foil, not light tested, 150x150mm, thickness 0.015mm, 99.9%; Cobalt, foil, not light tested, 150x150mm, thickness 0.01mm, 99.9%; Cobalt, foil, not light tested, 150x150mm, thickness 0.025mm, 99.9%; Cobalt, foil, not light tested, 25x25mm, thickness 0.003mm, 99.9%; Cobalt, foil, not light tested, 25x25mm, thickness 0.004mm, 99.9%; Cobalt, foil, not light tested, 25x25mm, thickness 0.005mm, 99.9%; Cobalt, foil, not light tested, 25x25mm, thickness 0.006mm, 99.9%; Cobalt, foil, not light tested, 25x25mm, thickness 0.007mm, 99.9%; Cobalt, foil, not light tested, 25x25mm, thickness 0.008mm, 99.9%; Cobalt, foil, not light tested, 25x25mm, thickness 0.009mm, 99.9%; Cobalt, foil, not light tested, 25x25mm, thickness 0.01mm, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.003mm, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.004mm, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.005mm, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.006mm, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.007mm, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.008mm, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.009mm, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.0125mm, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.015mm, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.01mm, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.025mm, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.02mm, 99.9%; Cobalt, foil, thickness 0.50 mm, size 125 x 125 mm, purity 99.9%; Cobalt, foil, thickness 1.0 mm, size 125 x 125 mm, purity 99.9%; Cobalt, foil, thickness 1.0 mm, size 250 x 250 mm, purity 99.9%; Cobalt, lump, 10 mm max. lump size, weight 100 g, high purity 99.99+%; Cobalt, lump, 10 mm max. lump size, weight 20 g, high purity 99.99+%; Cobalt, lump, 10 mm max. lump size, weight 50 g, high purity 99.99+%; Cobalt, lump, 40 mm max. lump size, weight 1000 g, purity 99.8%; Cobalt, lump, 40 mm max. lump size, weight 2000 g, purity 99.8%; Cobalt, powder, 45 max. part. size (micron), weight 100 g, purity 99.8%; Cobalt, powder, 45 max. part. size (micron), weight 200 g, purity 99.8%; Cobalt, powder, 7.5 max. part. size (micron), weight 50 g, purity 99.6%; Cobalt, powder, max. particle size 45 micron, weight 50 g, purity 99.8%; Cobalt, rod, 2.0 mm diameter, length 100 mm, high purity 99.99+%; Cobalt, rod, 2.0 mm diameter, length 200 mm, high purity 99.99+%; Cobalt, rod, length 100 mm, 1.5 mm diameter, high purity 99.99+%; Cobalt, rod, length 200 mm, 1.5 mm diameter, high purity 99.99+%; Cobalt pieces, 12mm (0.47in) & down, 99.5% (metals basis excluding Ni),; Cobalt single crystal, 10-12mm (0.39-0.47in) dia, (0001) orientation, +/-2 degrees; Cobalt slug, 6.35mm (0.25in) dia x 12.7mm (0.50in) length, 99.95% (metals basis); Cobalt slug, 6.35mm (0.25in) dia x 6.35mm (0.25in) length, 99.95% (metals basis); Cobalt slug, 6.35mm (0.25in) dia x 6.35mm (0.25in) length, 99.995% (metals basis); Cobalt standard solution, suitable for atomic absorption spectrometry, 1 mg/mL Co+2; Cobalt, Carbon coated magnetic, nanopowder, <50 nm particle size (TEM), >=99%; Cobalt, foil, light tested, 100x100mm, thickness 0.05mm, annealed, 99.9%; Cobalt, foil, light tested, 100x100mm, thickness 0.05mm, as rolled, 99.9%; Cobalt, foil, light tested, 100x100mm, thickness 0.05mm, as rolled, 99.99+%; Cobalt, foil, light tested, 250x250mm, thickness 0.05mm, annealed, 99.9%; Cobalt, foil, light tested, 25x25mm, thickness 0.05mm, as rolled, 99.99+%; Cobalt, foil, light tested, 50x50mm, thickness 0.05mm, as rolled, 99.99+%; Cobalt, foil, not light tested, 100x100mm, thickness 0.05mm, as rolled, 99.9%; Cobalt, foil, not light tested, 100x100mm, thickness 0.05mm, as rolled, 99.99+%; Cobalt, powder, 0.02 mean particle size (micron), weight 10 g, purity 99.9%; Cobalt, powder, 150 max. part. size (micron), weight 500 g, min. particle size 50 micron; Cobalt, powder, 7.5 max. part. size (micron), weight 100 g, purity 99.6%; Cobalt, powder, 840 max. part. size (micron), weight 10 g, high purity 99.99+%; Cobalt, powder, 840 max. part. size (micron), weight 100 g, high purity 99.99+%; Cobalt, powder, max. particle size 150 micron, weight 100 g, min. particle size 50 micron; Cobalt, powder, max. particle size 150 micron, weight 200 g, min. particle size 50 micron; Cobalt, powder, max. particle size 150 micron, weight 50 g, min. particle size 50 micron; Cobalt, powder, max. particle size 7.5 micron, weight 200 g, purity 99.6%; Cobalt, powder, max. particle size 840 micron, weight 20 g, high purity 99.99+%; Cobalt, powder, max. particle size 840 micron, weight 50 g, high purity 99.99+%; Cobalt, powder, mean particle size 0.02 micron, weight 20 g, purity 99.9%; Cobalt atomic spectroscopy standard concentrate 1.000 g Co, for ICP, for 1 l standard solution (content 1.000 g/l), ampule; Cobalt single crystal disc, 10mm (0.39in) dia, 2-3mm (0.08-0.1in) thick, (0001) orientation, +/-0.5 degrees; Cobalt sputtering target, 76.2mm (3.0in) dia x 6.35mm (0.250in) thick, 99.95% (metals basis); Cobalt, foil, not light tested, 25x25mm, thickness 0.001mm, temporary acrylic support, 99.9%; Cobalt, foil, not light tested, 25x25mm, thickness 0.0025mm, temporary acrylic support, 99.9%; Cobalt, foil, not light tested, 25x25mm, thickness 0.002mm, temporary acrylic support, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.001mm, temporary acrylic support, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.0025mm, temporary acrylic support, 99.9%; Cobalt, foil, not light tested, 50x50mm, thickness 0.002mm, temporary acrylic support, 99.9%; Cobalt, microfoil, disks, 10mm, thinness 0.1mum, specific density 94.6mug/cm2, permanent mylar 3.5mum support, 99.9%; Cobalt, microfoil, disks, 10mm, thinness 0.25mum, specific density 222mug/cm2, permanent mylar 3.5mum support, 99.9%; Cobalt, microfoil, disks, 10mm, thinness 0.5mum, specific density 434mug/cm2, permanent mylar 3.5mum support, 99.9%; Cobalt, microfoil, disks, 10mm, thinness 1.0mum, specific density 890mug/cm2, permanent mylar 3.5mum support, 99.9%; Cobalt, microfoil, disks, 25mm, thinness 0.1mum, specific density 94.6mug/cm2, permanent mylar 3.5mum support, 99.9%; Cobalt, microfoil, disks, 25mm, thinness 0.25mum, specific density 222mug/cm2, permanent mylar 3.5mum support, 99.9%; Cobalt, microfoil, disks, 25mm, thinness 0.5mum, specific density 434mug/cm2, permanent mylar 3.5mum support, 99.9%; Cobalt, microfoil, disks, 25mm, thinness 1.0mum, specific density 890mug/cm2, permanent mylar 3.5mum support, 99.9%; Cobalt, powder, 150 max. part. size (micron), weight 1000 g, min. particle size 50 micron']

Activity data

No relevant experimental diagram

Interaction ID 596
Target type Molecule
Target unique ID 23973
Activity 100 μM
Binding Conditions/Buffer

50 mM Tris-HCl, pH 7.5, 20 mM MgCl2

Assay

N/A

PubMed ID 11283591

No relevant experimental diagram

Interaction ID 619
Target type Molecule
Target unique ID 104730
Activity 100 μM
Binding Conditions/Buffer

50 mM Tris-HCl, pH 7.5, 20 mM MgCl2

Assay

N/A

PubMed ID 11283591

No relevant experimental diagram

Interaction ID 718
Target type Molecule
Target unique ID 23930
Activity 100 μM
Binding Conditions/Buffer

50 mM Tris-HCl, pH 7.5, 20 mM MgCl2

Assay

N/A

PubMed ID 11283591

No relevant experimental diagram

Interaction ID 726
Target type Molecule
Target unique ID 935
Activity 100 μM
Binding Conditions/Buffer

50 mM Tris-HCl, pH 7.5, 20 mM MgCl2

Assay

N/A

PubMed ID 11283591

No relevant experimental diagram

Interaction ID 805
Target type Molecule
Target unique ID 23994
Activity 100 μM
Binding Conditions/Buffer

50 mM Tris-HCl, pH 7.5, 20 mM MgCl2

Assay

N/A

PubMed ID 11283591
Similar aptamers
Aptamer ID Aptamer chemistry Sequence Similarity
Apta_710 RNA GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGUCUGGAUACCAUGCAUGAUGCACCUUGGCAGUCUUACGAAACGGUAGCGAGAGCUC 79.59%
Apta_561 RNA GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUGUGGAAACAGACGUGGCACAUGACUACGUCGAAACGGUAGCGAGAGCUC 78.57%
Apta_566 RNA GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCCUGCGAUGCAGAAAGGUGCUGACGACACAUCGAAACGGUAGCGAGAGCUC 77.55%
Apta_613 RNA GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUUAGGAUAUGCAUGAUGCAGAAGGACGUCGAAACGGUAGCGAGAGCUC 77.55%
Apta_562 RNA GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUUUAGGGCCAAGUGUGGUGAAAGACACACUCGAAACGGUAGCGAGAGCUC 76.53%
Apta_874 RNA GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUUAGGAUAUGUCUGGAUACCAUGCAUGAUGCACCUUGGCAGUCUUACAGAAGGACGUCGAAACGGUAGCGAGAGCUC 73.50%
Apta_295 RNA AUACCAGCUUAUUCAAUUGCCUGAAAAGCUAUCGCCCAAUUCGCAGUGAUAUCCUUUAAGAUAGUAAGUGCAAUCU 56.12%
Apta_416 RNA GGACCUCGGCGAAAGCCGGUAACGCCACAAGUCGGAGGGUAAGAUCUGACAGGAACUGGGUGACGGAGGUUAGGUGC 54.08%
Apta_429 RNA GCAUGCAGUGUCUAUUCUCGAGUAGCGAUCGUUGAAGGGGUAUAAGGUUGGCAGAUCGCUAGCAUGCAACUGACUCGGAUAAGCA 54.08%
Apta_766 RNA GGUUACCAGCCUUCACUGCGGACGGACAGAGAGUGCAACCUGCCGUGCCGCACCACGGUCGGUCACAC 54.08%
Apta_301 RNA AUACCAGCUUAUUCAAUUGCCUGAAAAGUUGAACUCCAAAUACGCGCUGAGAUAGUAAGUGCAAUCU 53.06%
Apta_551 RNA GGAUGUCCAGUCGCUUGCAAUGCCCUUUUAGACCCUGAUGAGCGGUGCUAGUUAGUUGCAGUUUCGGUUGUUACGCGAAACGGUGAAAGCCGUAGGUCU 52.53%
Apta_157 RNA GGGUUCACUGCAGACUUGACGAAGCUUACAAACAAGAGCAAAAAGGGAGUUGACGUAGACUGUGCGGAAUGGAUCCACAUCUACGAAUUC 52.04%
Apta_294 RNA AUACCAGCUUAUUCAAUUGCCUGAUUAGCGGUAUCACGAUUACUUACCUUCGUUGCUGAGAUAGUAAGUGCAAUCU 52.04%
Apta_297 RNA AUACCAGCUUAUUCAAUUGCCUGAGUAGCUGGGUCCGUCCCCACACAUUACCAUUUGUAGAUAGUAAGUGCAAUCU 52.04%
Apta_353 RNA GAAUUCCGCGUGUGCCAGCGAAAGUUGCGUAUGGGUCACAUCGCAGGCACAUGUCAUCUGGGCGGUCCGUUCGGGAUCC 52.04%
Apta_499 RNA GGACGCGUGGUACCAGGCCGAUCUAUGGACGCUAUAGGCACACCGGAUACUUUAACGAUUGGCUAAGCUUCCGCGGGGAUC 52.04%
Apta_690 RNA GGGCGAAUUCCCGAGGACCAAAUAGUACCACCCGGGAAAACAGCUAAUGCCGAAACGGAGAUUUUUUCUGCAGAAGCU 52.04%
Apta_280 RNA GAUAAUACGACUCACUAUAGGGUUCACUGCAGACUUGACGAAGCUUGCAGAAAAGGGGGAAGAAGAGGGUGAUUCAGGCGAGAGAAUGGAUCCACAUCUACGAAUUC 51.40%
Apta_123 RNA GGGAGAAAGGGAAGCUUGAGCAGCAGGAGGGCCGGCGUUAGGGUUAGCGAGCCGAUUGAAAGAAGAAGGAACGAGCGUACGGAUCCGAUC 51.02%