| Aptamer ID | Aptamer descriptor | Target chemistry | Target name | Affinity | Binding Conditions/Buffer | PubMed ID |
|---|---|---|---|---|---|---|
| Apta_563 | AR1 | Molecule | Cadmium | 100 μM | 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 | 11283591 |
| Aptamer Sequence: | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC |
| The optimal secondary structure in dot-bracket notation: | ........(((((.((((((....))))))((((((.....((....))....(((.(((...)))))))))))).......)))))(((....))). |
| The centroid secondary structure in dot-bracket notation: | ..............((((((....))))))((((((.....((....))....(((.((.....))))))))))).(((.....))).((....)).. |
| Type | Detail | Type | Detail |
|---|---|---|---|
| Aptamer ID | Apta_563 | Description | AR1 |
| Aptamer chemistry | RNA | Length | 98 nt |
| GC content | 54.1% | Molecular weight | 31,742.02 Da |
| Molarity of 1 μg/μl solution | 31.50 μM | Number of G-quadruplexes | No QGRS found |
| G-Score | N/A | Function | Aptasensor |
| Sequence | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC | ||
| Applications | Recognition of cAMP | ||
| Type | Detail | Type | Detail |
|---|---|---|---|
| PubChem ID | 23973 | Molecular name | Cadmium |
| Molecular formula | Cd | Molecular weight | 112.41 |
| IUPAC name | cadmium | InChIKey | BDOSMKKIYDKNTQ-UHFFFAOYSA-N |
| LogP | -0.003 | Topological polar surface area | 0 |
| Hydrogen bond acceptor | 0 | Hydrogen bond donor | 0 |
Synonym(s): 7440-43-9; Cadmium; Cd; Colloidal cadmium; Cadmium, elemental; Kadmium; UNII-00BH33GNGH; Cadmium hydride (CdH2); 00BH33GNGH; Cadmium compounds; MFCD00010914; Kadmium [German]; 72172-64-6; cadmio; Cadmium powder; Cadmium, Reference Standard Solution; CCRIS 112; HSDB 282; 81271-94-5; Cadmium, mass of 135; EINECS 231-152-8; Cadmium metal; Cadmium pieces; C I 77180; Cadmium granules; C.I. 77180; Elemental cadmium; CD135; Cadmium single crystal, 15mm (0.59in) dia, 50mm (2.0in) long, (111) orientation, +/-2 degrees; Cadmium, p.a.; Cadmium metal-sticks; Cadmium shot, 3N5; Cadmium [Cadmium and cadmium compounds]; Cadmium powder 325 mesh; 48Cd; Cadmium, >=99.9%; EC 231-152-8; Cadmium powder - 100mesh; Cadmium [Cadmium and certain cadmium compounds]; Cadmium powder, -200 mesh; Cadmium powder, -325 mesh; Cadmium, thermovacuum aerosol; Aerosol of thermovacuum cadmium; Cadmium shot, 5cm (2in) dia; DTXSID1023940; NIOSH/EV3380000; CHEBI:22977; CHEBI:37249; Cadmium powder, 99.999%, 5N; 8234AF; AKOS015902734; Cadmium rod, 12.7mm (0.5in) dia; DB14085; Cadmium foil, 0.5mm (0.02in) thick; Cadmium shot, tear drop, -5+20 mesh; Cadmium shot, tear drop, 3mm (0.1in); Cadmium, granular, >=99%, 5-20 mesh; Cadmium, granular, 30-80 mesh, >=99%; Cadmium, purum p.a., for filling reductors; Cadmium rod, 8mm (0.3in) dia, Puratronic; EV33800000; Q1091; C01413; Cadmium, rod, 25mm, diameter 40mm, 99.9%; Cadmium, rod, 50mm, diameter 40mm, 99.9%; H11246; Cadmium, rod, 100mm, diameter 40mm, 99.9%; Cadmium shot, 1-3mm (0.04-0.1in), Puratronic?; Cadmium wire, 0.64mm (0.025in) dia, Puratronic; Cadmium, rod, 50mm, diameter 10.0mm, 99.999%; Cadmium, shot, 3 mm, 99.999% trace metals basis; Cadmium foil, 0.025mm (0.001in) thick, Puratronic; Cadmium, rod, 100mm, diameter 10.0mm, 99.999%; Cadmium, rod, 200mm, diameter 10.0mm, 99.999%; Cadmium, foil, 4mm disks, thickness 0.01mm, 99.7+%; Cadmium, foil, 6mm disks, thickness 0.01mm, 99.7+%; Cadmium, foil, 8mm disks, thickness 0.01mm, 99.7+%; Cadmium, powder, -100 mesh, 99.5% trace metals basis; Cadmium, foil, 10mm disks, thickness 0.005mm, 99.7+%; Cadmium, foil, 10mm disks, thickness 0.015mm, 99.7+%; Cadmium, foil, 10mm disks, thickness 0.01mm, 99.7+%; Cadmium, foil, 10mm disks, thickness 0.025mm, 99.7+%; Cadmium, foil, 15mm disks, thickness 0.005mm, 99.7+%; Cadmium, foil, 15mm disks, thickness 0.015mm, 99.7+%; Cadmium, foil, 15mm disks, thickness 0.01mm, 99.7+%; Cadmium, foil, 15mm disks, thickness 0.025mm, 99.7+%; Cadmium, foil, 4mm disks, thickness 0.005mm, 99.7+%; Cadmium, foil, 4mm disks, thickness 0.015mm, 99.7+%; Cadmium, foil, 4mm disks, thickness 0.025mm, 99.7+%; Cadmium, foil, 6mm disks, thickness 0.005mm, 99.7+%; Cadmium, foil, 6mm disks, thickness 0.015mm, 99.7+%; Cadmium, foil, 6mm disks, thickness 0.025mm, 99.7+%; Cadmium, foil, 8mm disks, thickness 0.005mm, 99.7+%; Cadmium, foil, 8mm disks, thickness 0.015mm, 99.7+%; Cadmium, foil, 8mm disks, thickness 0.025mm, 99.7+%; Cadmium, rod, diam. 4.0 mm, 99.999% trace metals basis; Cadmium, wire reel, 1m, diameter 0.5mm, hard, 99.95+%; Cadmium, wire reel, 1m, diameter 0.5mm, hard, 99.99+%; Cadmium, wire reel, 1m, diameter 1.0mm, hard, 99.999%; Cadmium, wire reel, 2m, diameter 0.5mm, hard, 99.95+%; Cadmium, wire reel, 2m, diameter 0.5mm, hard, 99.99+%; Cadmium, wire reel, 5m, diameter 0.5mm, hard, 99.95+%; Cadmium, wire reel, 5m, diameter 0.5mm, hard, 99.99+%; Cadmium wire, 0.5mm (0.02in) dia, 99.998% (metals basis); Cadmium wire, 1.0mm (0.04in) dia, 99.998% (metals basis); Cadmium wire, 2.0mm (0.08in) dia, 99.998% (metals basis); Cadmium, foil, 0.5m coil, thickness 0.5mm, as rolled, 100%; Cadmium, foil, 10mm disks, thickness 1.0mm, as rolled, 100%; Cadmium, foil, 15mm disks, thickness 1.0mm, as rolled, 100%; Cadmium, foil, 1m coil, thickness 0.5mm, as rolled, 100%; Cadmium, foil, 25mm disks, thickness 1.0mm, as rolled, 100%; Cadmium, foil, 2m coil, thickness 0.5mm, as rolled, 100%; Cadmium, foil, 4mm disks, thickness 1.0mm, as rolled, 100%; Cadmium, foil, 50mm disks, thickness 1.0mm, as rolled, 100%; Cadmium, foil, 50x50mm, thickness 3.0mm, as rolled, 99.9%; Cadmium, foil, 6mm disks, thickness 1.0mm, as rolled, 100%; Cadmium, foil, 8mm disks, thickness 1.0mm, as rolled, 100%; Cadmium, purum p.a., for metal reduction, 99.99%, granular; Cadmium, rod, 1000mm, diameter 5.0mm, as drawn, 99.99+%; Cadmium, rod, 100mm, diameter 5.0mm, as drawn, 99.99+%; Cadmium, rod, 150mm, diameter 10.0mm, as drawn, 99.99+%; Cadmium, rod, 200mm, diameter 5.0mm, as drawn, 99.99+%; Cadmium, rod, 300mm, diameter 10.0mm, as drawn, 99.99+%; Cadmium, rod, 500mm, diameter 5.0mm, as drawn, 99.99+%; Cadmium, wire reel, 0.1m, diameter 0.25mm, hard, 99.99+%; Cadmium, wire reel, 0.1m, diameter 0.5mm, hard, 99.95+%; Cadmium, wire reel, 0.1m, diameter 0.5mm, hard, 99.99+%; Cadmium, wire reel, 0.1m, diameter 1.0mm, hard, 99.999%; Cadmium, wire reel, 0.1m, diameter 2.0mm, hard, 99.99+%; Cadmium, wire reel, 0.2m, diameter 0.25mm, hard, 99.99+%; Cadmium, wire reel, 0.2m, diameter 0.5mm, hard, 99.95+%; Cadmium, wire reel, 0.2m, diameter 0.5mm, hard, 99.99+%; Cadmium, wire reel, 0.2m, diameter 1.0mm, hard, 99.999%; Cadmium, wire reel, 0.2m, diameter 2.0mm, hard, 99.99+%; Cadmium, wire reel, 0.5m, diameter 0.25mm, hard, 99.99+%; Cadmium, wire reel, 0.5m, diameter 0.5mm, hard, 99.95+%; Cadmium, wire reel, 0.5m, diameter 0.5mm, hard, 99.99+%; Cadmium, wire reel, 0.5m, diameter 1.0mm, hard, 99.999%; Cadmium, wire reel, 0.5m, diameter 2.0mm, hard, 99.99+%; Cadmium, wire reel, 10m, diameter 0.25mm, hard, 99.99+%; Cadmium, wire reel, 1m, diameter 0.125mm, as drawn, 99.9%; Cadmium, wire reel, 1m, diameter 0.25mm, hard, 99.99+%; Cadmium, wire reel, 1m, diameter 1.2mm, as drawn, 99.99+%; Cadmium, wire reel, 2m, diameter 0.125mm, as drawn, 99.9%; Cadmium, wire reel, 2m, diameter 1.2mm, as drawn, 99.99+%; Cadmium, wire reel, 5m, diameter 0.125mm, as drawn, 99.9%; Cadmium, wire reel, 5m, diameter 0.25mm, hard, 99.99+%; Cadmium, wire, diam. 1.0 mm, 99.999% trace metals basis; Cadmium foil, 0.05mm (0.002in) thick, 99.999% (metals basis); Cadmium foil, 0.1mm (0.004in) thick, 99.9975% (metals basis); Cadmium foil, 0.25mm (0.01in) thick, 99.9975% (metals basis); Cadmium foil, 0.5mm (0.02in) thick, 99.9975% (metals basis); Cadmium foil, 1.0mm (0.04in) thick, 15x15cm (5.9x5.9in); Cadmium foil, 1.0mm (0.04in) thick, 99.998% (metals basis); Cadmium foil, 2.0mm (0.08in) thick, 99.998% (metals basis); Cadmium ingot/button, ca. 36mm (1.4in) dia x 8mm (0.3in) thick; Cadmium wire, 0.3mm (0.013in) dia, 99.999% (metals basis); Cadmium, foil, 100x100mm, thickness 0.25mm, as rolled, 99.99%; Cadmium, foil, 100x100mm, thickness 0.5mm, as rolled, 99.95%; Cadmium, foil, 100x100mm, thickness 1.0mm, as rolled, 99.99%; Cadmium, foil, 100x100mm, thickness 2.0mm, as rolled, 99.99%; Cadmium, foil, 100x100mm, thickness 3.0mm, as rolled, 99.9%; Cadmium, foil, 10mm disks, thickness 0.05mm, as rolled, 99.99+%; Cadmium, foil, 10mm disks, thickness 0.125mm, as rolled, 99.95%; Cadmium, foil, 10mm disks, thickness 0.25mm, as rolled, 99.9%; Cadmium, foil, 10mm disks, thickness 0.25mm, as rolled, 99.95%; Cadmium, foil, 10mm disks, thickness 0.25mm, as rolled, 99.99+%; Cadmium, foil, 10mm disks, thickness 0.5mm, as rolled, 99.95%; Cadmium, foil, 10mm disks, thickness 1.0mm, as rolled, 99.95%; Cadmium, foil, 150x150mm, thickness 0.25mm, as rolled, 99.95%; Cadmium, foil, 150x150mm, thickness 0.5mm, as rolled, 99.99%; Cadmium, foil, 150x150mm, thickness 1.0mm, as rolled, 99.95%; Cadmium, foil, 150x150mm, thickness 3.0mm, as rolled, 99.9%; Cadmium, foil, 15mm disks, thickness 0.05mm, as rolled, 99.99+%; Cadmium, foil, 15mm disks, thickness 0.125mm, as rolled, 99.95%; Cadmium, foil, 15mm disks, thickness 0.25mm, as rolled, 99.9%; Cadmium, foil, 15mm disks, thickness 0.25mm, as rolled, 99.95%; Cadmium, foil, 15mm disks, thickness 0.25mm, as rolled, 99.99+%; Cadmium, foil, 15mm disks, thickness 0.5mm, as rolled, 99.95%; Cadmium, foil, 15mm disks, thickness 1.0mm, as rolled, 99.95%; Cadmium, foil, 195x200mm, thickness 1.0mm, as rolled, 99.95%; Cadmium, foil, 200x200mm, thickness 0.5mm, as rolled, 99.99%; Cadmium, foil, 200x200mm, thickness 1.0mm, as rolled, 99.99%; Cadmium, foil, 25mm disks, thickness 0.05mm, as rolled, 99.99+%; Cadmium, foil, 25mm disks, thickness 0.125mm, as rolled, 99.95%; Cadmium, foil, 25mm disks, thickness 0.25mm, as rolled, 99.9%; Cadmium, foil, 25mm disks, thickness 0.25mm, as rolled, 99.95%; Cadmium, foil, 25mm disks, thickness 0.25mm, as rolled, 99.99+%; Cadmium, foil, 25mm disks, thickness 0.5mm, as rolled, 99.95%; Cadmium, foil, 25mm disks, thickness 1.0mm, as rolled, 99.95%; Cadmium, foil, 25x25mm, thickness 0.125mm, as rolled, 99.99+%; Cadmium, foil, 25x25mm, thickness 0.25mm, as rolled, 99.9%; Cadmium, foil, 25x25mm, thickness 0.25mm, as rolled, 99.99+%; Cadmium, foil, 25x25mm, thickness 0.5mm, as rolled, 99.999%; Cadmium, foil, 25x25mm, thickness 1.0mm, as rolled, 99.999%; Cadmium, foil, 300x1000mm, thickness 2.0mm, as rolled, 99.99%; Cadmium, foil, 300x300mm, thickness 0.25mm, as rolled, 99.95%; Cadmium, foil, 300x300mm, thickness 0.5mm, as rolled, 99.99%; Cadmium, foil, 300x300mm, thickness 2.0mm, as rolled, 99.99%; Cadmium, foil, 30x100mm, thickness 0.5mm, as rolled, 99.999%; Cadmium, foil, 30x150mm, thickness 0.5mm, as rolled, 99.999%; Cadmium, foil, 30x50mm, thickness 0.5mm, as rolled, 99.999%; Cadmium, foil, 4mm disks, thickness 0.05mm, as rolled, 99.99+%; Cadmium, foil, 4mm disks, thickness 0.125mm, as rolled, 99.95%; Cadmium, foil, 4mm disks, thickness 0.125mm, as rolled, 99.99+%; Cadmium, foil, 4mm disks, thickness 0.25mm, as rolled, 99.9%; Cadmium, foil, 4mm disks, thickness 0.25mm, as rolled, 99.95%; Cadmium, foil, 4mm disks, thickness 0.25mm, as rolled, 99.99+%; Cadmium, foil, 4mm disks, thickness 0.5mm, as rolled, 99.95%; Cadmium, foil, 4mm disks, thickness 1.0mm, as rolled, 99.95%; Cadmium, foil, 50mm disks, thickness 0.05mm, as rolled, 99.99+%; Cadmium, foil, 50mm disks, thickness 0.125mm, as rolled, 99.95%; Cadmium, foil, 50mm disks, thickness 0.25mm, as rolled, 99.95%; Cadmium, foil, 50mm disks, thickness 0.5mm, as rolled, 99.95%; Cadmium, foil, 50x100mm, thickness 1.0mm, as rolled, 99.999%; Cadmium, foil, 50x200mm, thickness 1.0mm, as rolled, 99.999%; Cadmium, foil, 50x50mm, thickness 0.125mm, as rolled, 99.95%; Cadmium, foil, 50x50mm, thickness 0.125mm, as rolled, 99.99+%; Cadmium, foil, 50x50mm, thickness 0.25mm, as rolled, 99.9%; Cadmium, foil, 50x50mm, thickness 0.25mm, as rolled, 99.99+%; Cadmium, foil, 50x50mm, thickness 1.0mm, as rolled, 99.95%; Cadmium, foil, 50x50mm, thickness 1.0mm, as rolled, 99.999%; Cadmium, foil, 50x50mm, thickness 2.0mm, as rolled, 99.99%; Cadmium, foil, 6mm disks, thickness 0.05mm, as rolled, 99.99+%; Cadmium, foil, 6mm disks, thickness 0.125mm, as rolled, 99.95%; Cadmium, foil, 6mm disks, thickness 0.125mm, as rolled, 99.99+%; Cadmium, foil, 6mm disks, thickness 0.25mm, as rolled, 99.9%; Cadmium, foil, 6mm disks, thickness 0.25mm, as rolled, 99.95%; Cadmium, foil, 6mm disks, thickness 0.25mm, as rolled, 99.99+%; Cadmium, foil, 6mm disks, thickness 0.5mm, as rolled, 99.95%; Cadmium, foil, 6mm disks, thickness 1.0mm, as rolled, 99.95%; Cadmium, foil, 71x179mm, thickness 1.0mm, as rolled, 99.95%; Cadmium, foil, 75x100mm, thickness 0.5mm, as rolled, 99.99%; Cadmium, foil, 8mm disks, thickness 0.05mm, as rolled, 99.99+%; Cadmium, foil, 8mm disks, thickness 0.125mm, as rolled, 99.95%; Cadmium, foil, 8mm disks, thickness 0.125mm, as rolled, 99.99+%; Cadmium, foil, 8mm disks, thickness 0.25mm, as rolled, 99.9%; Cadmium, foil, 8mm disks, thickness 0.25mm, as rolled, 99.95%; Cadmium, foil, 8mm disks, thickness 0.25mm, as rolled, 99.99+%; Cadmium, foil, 8mm disks, thickness 0.5mm, as rolled, 99.95%; Cadmium, foil, 8mm disks, thickness 1.0mm, as rolled, 99.95%; Cadmium, foil, 95x100mm, thickness 0.5mm, as rolled, 99.99%; Cadmium, foil, light tested, 25x25mm, thickness 0.01mm, 99.7+%; Cadmium, foil, light tested, 50x50mm, thickness 0.01mm, 99.7+%; Cadmium, foil, thickness 0.5 mm, >=99.99% trace metals basis; Cadmium, lump, 5 mm max. lump size, weight 50 g, purity 99.99+%; Cadmium, rod, 99.9999% (6N), diameter 21 mm, length 55 mm; Cadmium, shots, 99.99999% (7N), diameter 2-4 mm, vacuum bags; Cadmium, stick, thickness 10 mm, >=99.999% trace metals basis; Cadmium, wire reel, 0.1m, diameter 0.125mm, as drawn, 99.9%; Cadmium, wire reel, 0.1m, diameter 0.70mm, as drawn, 99.99+%; Cadmium, wire reel, 0.1m, diameter 1.2mm, as drawn, 99.99+%; Cadmium, wire reel, 0.2m, diameter 0.125mm, as drawn, 99.9%; Cadmium, wire reel, 0.2m, diameter 0.70mm, as drawn, 99.99+%; Cadmium, wire reel, 0.2m, diameter 1.2mm, as drawn, 99.99+%; Cadmium, wire reel, 0.5m, diameter 0.125mm, as drawn, 99.9%; Cadmium, wire reel, 0.5m, diameter 0.70mm, as drawn, 99.99+%; Cadmium, wire reel, 0.5m, diameter 1.2mm, as drawn, 99.99+%; Cadmium, wire reel, 1m, diameter 0.70mm, as drawn, 99.99+%; Cadmium, wire reel, 2m, diameter 0.70mm, as drawn, 99.99+%; AQUANAL(TM)-plus cadmium (Cd) 0.02-1.2 mg/L, refill pack for 37432; Cadmium standard for IC, ready-to-use, traceable to BAM, in nitric acid; Cadmium, foil, 100x100mm, thickness 0.125mm, as rolled, 99.95%; Cadmium, foil, 100x100mm, thickness 0.125mm, as rolled, 99.99+%; Cadmium, foil, 100x100mm, thickness 0.25mm, as rolled, 99.99+%; Cadmium, foil, 100x200mm, thickness 0.125mm, as rolled, 99.95%; Cadmium, foil, 100x300mm, thickness 0.125mm, as rolled, 99.95%; Cadmium, foil, 10mm disks, thickness 0.125mm, as rolled, 99.99+%; Cadmium, foil, 15mm disks, thickness 0.125mm, as rolled, 99.99+%; Cadmium, foil, 25mm disks, thickness 0.125mm, as rolled, 99.99+%; Cadmium, foil, 50mm disks, thickness 0.125mm, as rolled, 99.99+%; Cadmium, foil, light tested, 100x100mm, thickness 0.015mm, 99.7+%; Cadmium, foil, light tested, 100x100mm, thickness 0.025mm, 99.7+%; Cadmium, foil, light tested, 25x25mm, thickness 0.005mm, 99.7+%; Cadmium, foil, light tested, 25x25mm, thickness 0.015mm, 99.7+%; Cadmium, foil, light tested, 25x25mm, thickness 0.025mm, 99.7+%; Cadmium, foil, light tested, 50x50mm, thickness 0.015mm, 99.7+%; Cadmium, foil, light tested, 50x50mm, thickness 0.025mm, 99.7+%; Cadmium, foil, not light tested, 100x100mm, thickness 0.005mm, 99.7+%; Cadmium, foil, not light tested, 100x100mm, thickness 0.015mm, 99.7+%; Cadmium, foil, not light tested, 100x100mm, thickness 0.01mm, 99.7+%; Cadmium, foil, not light tested, 100x100mm, thickness 0.025mm, 99.7+%; Cadmium, foil, not light tested, 25x25mm, thickness 0.001mm, 99.7+%; Cadmium, foil, not light tested, 25x25mm, thickness 0.002mm, 99.7+%; Cadmium, foil, not light tested, 25x25mm, thickness 0.005mm, 99.7+%; Cadmium, foil, not light tested, 25x25mm, thickness 0.015mm, 99.7+%; Cadmium, foil, not light tested, 25x25mm, thickness 0.01mm, 99.7+%; Cadmium, foil, not light tested, 25x25mm, thickness 0.025mm, 99.7+%; Cadmium, foil, not light tested, 50x50mm, thickness 0.002mm, 99.7+%; Cadmium, foil, not light tested, 50x50mm, thickness 0.005mm, 99.7+%; Cadmium, foil, not light tested, 50x50mm, thickness 0.015mm, 99.7+%; Cadmium, foil, not light tested, 50x50mm, thickness 0.01mm, 99.7+%; Cadmium, lump, 100 mm max. lump size, weight 100 g, purity 99.99%; Cadmium, lump, 100 mm max. lump size, weight 1000 g, purity 99.99%; Cadmium, lump, 100 mm max. lump size, weight 200 g, purity 99.99%; Cadmium, lump, 100 mm max. lump size, weight 500 g, purity 99.99%; Cadmium, lump, 5 mm max. lump size, weight 100 g, purity 99.99+%; Cadmium, lump, 5 mm max. lump size, weight 200 g, purity 99.99+%; AQUANAL(TM)-plus cadmium (Cd) 0.02-1.2 mg/L, test set with color comparator; Cadmium rod, 12.7mm (0.5in) dia x 23cm (9.0in), 99.999% (metals basis); Cadmium single crystal, 15mm (0.59in) dia, 50mm (2.0in) long, random orientation; Cadmium, foil, light tested, 100x100mm, thickness 0.05mm, as rolled, 99.99+%; Cadmium, foil, light tested, 25x25mm, thickness 0.05mm, as rolled, 99.99+%; Cadmium, foil, light tested, 50x50mm, thickness 0.05mm, as rolled, 99.99+%; Cadmium, powder, max. particle size 60 micron, weight 100 g, purity 99.9%; Cadmium, powder, max. particle size 60 micron, weight 1000 g, purity 99.9%; Cadmium, powder, max. particle size 60 micron, weight 200 g, purity 99.9%; Cadmium, powder, max. particle size 60 micron, weight 500 g, purity 99.9%; AQUANAL(TM)-plus cadmium (Cd) 0.02-1.2 mg/L, check solution for 37432 (calibrated standard (Cd = 0.015 mg/mL)); Cadmium single crystal disc, 10mm (0.39in) dia, 1-3mm (0.04-0.1in) thick, (100) orientation, +/-0.5 degrees; Cadmium single crystal, 15mm (0.59in) dia, 50mm (2.0in) long, (100) orientation, +/-2 degrees; Cadmium single crystal, 15mm (0.59in) dia, 50mm (2.0in) long, (110) orientation, +/-2 degrees; Cadmium standard solution, suitable for atomic absorption spectrometry, 1 mg/mL Cd+2, 1000 ppm Cd+2; Cadmium, tube, 1000mm, outside diameter 2.29mm, inside diameter 1.27mm, wall thickness 0.51mm, 99.95+%; Cadmium, tube, 100mm, outside diameter 2.29mm, inside diameter 1.27mm, wall thickness 0.51mm, 99.95+%; Cadmium, tube, 200mm, outside diameter 2.29mm, inside diameter 1.27mm, wall thickness 0.51mm, 99.95+%; Cadmium, tube, 500mm, outside diameter 2.29mm, inside diameter 1.27mm, wall thickness 0.51mm, 99.95+%']
|
No relevant experimental diagram |
Interaction ID | 596 |
| Target type | Molecule | |
| Target unique ID | 23973 | |
| Activity | 100 μM | |
| Binding Conditions/Buffer | 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 |
|
| Assay | N/A |
|
| PubMed ID | 11283591 | |
|
No relevant experimental diagram |
Interaction ID | 619 |
| Target type | Molecule | |
| Target unique ID | 104730 | |
| Activity | 100 μM | |
| Binding Conditions/Buffer | 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 |
|
| Assay | N/A |
|
| PubMed ID | 11283591 | |
|
No relevant experimental diagram |
Interaction ID | 718 |
| Target type | Molecule | |
| Target unique ID | 23930 | |
| Activity | 100 μM | |
| Binding Conditions/Buffer | 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 |
|
| Assay | N/A |
|
| PubMed ID | 11283591 | |
|
No relevant experimental diagram |
Interaction ID | 726 |
| Target type | Molecule | |
| Target unique ID | 935 | |
| Activity | 100 μM | |
| Binding Conditions/Buffer | 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 |
|
| Assay | N/A |
|
| PubMed ID | 11283591 | |
|
No relevant experimental diagram |
Interaction ID | 805 |
| Target type | Molecule | |
| Target unique ID | 23994 | |
| Activity | 100 μM | |
| Binding Conditions/Buffer | 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 |
|
| Assay | N/A |
|
| PubMed ID | 11283591 |
| Aptamer ID | Aptamer chemistry | Sequence | Similarity |
|---|---|---|---|
| Apta_710 | RNA | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGUCUGGAUACCAUGCAUGAUGCACCUUGGCAGUCUUACGAAACGGUAGCGAGAGCUC | |
| Apta_561 | RNA | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUGUGGAAACAGACGUGGCACAUGACUACGUCGAAACGGUAGCGAGAGCUC | |
| Apta_566 | RNA | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCCUGCGAUGCAGAAAGGUGCUGACGACACAUCGAAACGGUAGCGAGAGCUC | |
| Apta_613 | RNA | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUUAGGAUAUGCAUGAUGCAGAAGGACGUCGAAACGGUAGCGAGAGCUC | |
| Apta_562 | RNA | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUUUAGGGCCAAGUGUGGUGAAAGACACACUCGAAACGGUAGCGAGAGCUC | |
| Apta_874 | RNA | GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUUAGGAUAUGUCUGGAUACCAUGCAUGAUGCACCUUGGCAGUCUUACAGAAGGACGUCGAAACGGUAGCGAGAGCUC | |
| Apta_295 | RNA | AUACCAGCUUAUUCAAUUGCCUGAAAAGCUAUCGCCCAAUUCGCAGUGAUAUCCUUUAAGAUAGUAAGUGCAAUCU | |
| Apta_416 | RNA | GGACCUCGGCGAAAGCCGGUAACGCCACAAGUCGGAGGGUAAGAUCUGACAGGAACUGGGUGACGGAGGUUAGGUGC | |
| Apta_429 | RNA | GCAUGCAGUGUCUAUUCUCGAGUAGCGAUCGUUGAAGGGGUAUAAGGUUGGCAGAUCGCUAGCAUGCAACUGACUCGGAUAAGCA | |
| Apta_766 | RNA | GGUUACCAGCCUUCACUGCGGACGGACAGAGAGUGCAACCUGCCGUGCCGCACCACGGUCGGUCACAC | |
| Apta_301 | RNA | AUACCAGCUUAUUCAAUUGCCUGAAAAGUUGAACUCCAAAUACGCGCUGAGAUAGUAAGUGCAAUCU | |
| Apta_551 | RNA | GGAUGUCCAGUCGCUUGCAAUGCCCUUUUAGACCCUGAUGAGCGGUGCUAGUUAGUUGCAGUUUCGGUUGUUACGCGAAACGGUGAAAGCCGUAGGUCU | |
| Apta_157 | RNA | GGGUUCACUGCAGACUUGACGAAGCUUACAAACAAGAGCAAAAAGGGAGUUGACGUAGACUGUGCGGAAUGGAUCCACAUCUACGAAUUC | |
| Apta_294 | RNA | AUACCAGCUUAUUCAAUUGCCUGAUUAGCGGUAUCACGAUUACUUACCUUCGUUGCUGAGAUAGUAAGUGCAAUCU | |
| Apta_297 | RNA | AUACCAGCUUAUUCAAUUGCCUGAGUAGCUGGGUCCGUCCCCACACAUUACCAUUUGUAGAUAGUAAGUGCAAUCU | |
| Apta_353 | RNA | GAAUUCCGCGUGUGCCAGCGAAAGUUGCGUAUGGGUCACAUCGCAGGCACAUGUCAUCUGGGCGGUCCGUUCGGGAUCC | |
| Apta_499 | RNA | GGACGCGUGGUACCAGGCCGAUCUAUGGACGCUAUAGGCACACCGGAUACUUUAACGAUUGGCUAAGCUUCCGCGGGGAUC | |
| Apta_690 | RNA | GGGCGAAUUCCCGAGGACCAAAUAGUACCACCCGGGAAAACAGCUAAUGCCGAAACGGAGAUUUUUUCUGCAGAAGCU | |
| Apta_280 | RNA | GAUAAUACGACUCACUAUAGGGUUCACUGCAGACUUGACGAAGCUUGCAGAAAAGGGGGAAGAAGAGGGUGAUUCAGGCGAGAGAAUGGAUCCACAUCUACGAAUUC | |
| Apta_123 | RNA | GGGAGAAAGGGAAGCUUGAGCAGCAGGAGGGCCGGCGUUAGGGUUAGCGAGCCGAUUGAAAGAAGAAGGAACGAGCGUACGGAUCCGAUC |